rs130329 chr22:42665588 C>A
- Sequence
agatcacctcttctagggagcaat[C/A]tgtggctgatggaggagagtgggg
- ASB in cell types
- germinal center B-cells
- ASB for transcription factors
- CBP_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CBP_HUMAN | 2.34 | -1.38 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood