rs13033617 chr2:10386254 C>G
- Sequence
agagcccaccatggctccctgttg[C/G]caaatgcagcctgaattcagtatt
- ASB in cell types
- SUM159PT (Triple negative breast cancer)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SUM159PT (Triple negative breast cancer) | 1.24 | -0.55 | 1.75 |
Items per page:
1 – 1 of 1