rs13035558 chr2:47904797 T>C
- Sequence
gggctggaaatggccgatggattc[T/C]atatttatttatttaaaggtcttg
- ASB in cell types
- HEK293 (embryonic kidney) HepG2 (hepatoblastoma) K562 (myelogenous leukemia)
- ASB for transcription factors
- TYY1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TYY1_HUMAN | 0.16 | 2.14 | 1.80 | n/a | No Hit |
Items per page:
1 – 1 of 1