rs13071572 chr3:18217730 G>T
- Sequence
aaagtgtttacacatagagcacat[G/T]ccagcatgttttattattgttatt
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- FOXA1_HUMAN ZN843_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | -0.86 | 2.01 | 1.67 | n/a | No Hit | |||
| ZN843_HUMAN | -1.98 | 2.78 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, height, ldl cholesterol change with statins, parkinsons disease, total cholesterol change with statins