rs13078985 chr3:187336484 T>C
- Sequence
cctaatggagcacagcagtaaggc[T/C]aaaggggagccttgtaattagtgg
- ASB in cell types
- 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 2.77 | -5.29 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Spinal_cord_cervical_c-1, Esophagus_Muscularis, Lung, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Stomach, Thyroid, Whole_Blood