rs131333 chr22:23496013 G>A
- Sequence
gggaagtggctgagccctctaccc[G/A]catcctgtcacccccacccctgca
- ASB in cell types
- TSU-1621-MT (adult acute myeloid leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| TSU-1621-MT (adult acute myeloid leukemia) | -0.61 | 2.27 | 1.50 |
Items per page:
1 – 1 of 1