rs131357 chr22:23518319 C>T
- Sequence
cccctccccacctgatattttcat[C/T]aggacacatcttctgcaccaggcc
- ASB in cell types
- Kelly (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Kelly (neuroblastoma) | -0.01 | 1.48 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), aortic valve calcium, bipolar disorder, bipolar disorder and schizophrenia, hdl cholesterol, schizophrenia, serum creatinine, suicide attempts in bipolar disorder (substance free)
GTEx eQTL Artery_Tibial, Breast_Mammary_Tissue, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid