rs1316658 chr3:130850713 T>G
- Sequence
ttgctttgtttgtaggagggaagt[T/G]gtcgagctacaaacaaatctttag
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) GM12878 (female B-cells lymphoblastoid cell line) monocyte-derived dendritic cells CD14+ monocytes
- ASB for transcription factors
- SPI1_HUMAN STAT1_HUMAN SMCA4_HUMAN ETS1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 0.27 | 1.90 | 1.27 | 2.73 | Concordant | |||
| STAT1_HUMAN | -0.68 | 1.73 | 2.50 | n/a | No Hit | |||
| SMCA4_HUMAN | -0.18 | 1.30 | 1.06 | n/a | n/a | |||
| ETS1_HUMAN | -1.55 | 1.71 | 1.00 | 2.07 | Concordant | |||
| RELB_HUMAN | -1.54 | 1.89 | 1.00 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Uterus, Whole_Blood