rs1317380 chr8:104389919 T>G
- Sequence
attgatagtgaactcataaaaatt[T/G]cagttggcattaattctgccaaaa
- ASB in cell types
- GM18526 (B – cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18526 (B – cells Lymphoblastoid Cell Lines) | -0.90 | 1.23 | 1.00 |
Items per page:
1 – 1 of 1