rs13178677 chr5:154487661 T>C
- Sequence
ctttctgcctgctctatctgataa[T/C]agtttagggttgtccttgcccgag
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM12890 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.43 | 0.81 | 1.09 | |||
| GM12890 (Lymphoblastoid Cell Lines) | 1.80 | -1.05 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, diastolic blood pressure (dbp), late onset alzheimers disease, ldl cholesterol
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood