rs131805 chr22:50525724 T>C
- Sequence
ccccgcctccgcagccctggatcc[T/C]tccgctcccgcccaagcactgaca
- ASB in cell types
- HEK293 (embryonic kidney) HCT-116 (colon carcinoma) CD14+ monocytes GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- ERG_HUMAN ZFX_HUMAN STAT1_HUMAN CENPT_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ERG_HUMAN | 1.72 | -2.92 | 1.33 | -3.09 | Concordant | |||
| ZFX_HUMAN | 2.26 | -0.78 | 1.00 | n/a | No Hit | |||
| STAT1_HUMAN | n/a | 2.47 | 3.00 | n/a | No Hit | |||
| CENPT_HUMAN | -1.38 | 1.73 | 1.00 | n/a | n/a | |||
| EGR1_HUMAN | 1.65 | 1.25 | 1.67 | 0.60 | Weak Discordant |
Items per page:
1 – 5 of 5
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood