rs13228657 chr7:48139580 T>C
- Sequence
agtcaggcttctccacatggaaac[T/C]ccttagtttcactggccacggcca
- ASB in cell types
- GM19099 (female B-cells Lymphoblastoid Cell Lines) foreskin keratinocyte epithelial cell of prostate ID00014 (lymphoblastoid cell, DiGeorge syndrome)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | -0.71 | 2.76 | 1.00 | |||
| foreskin keratinocyte | 2.79 | -0.31 | 2.00 | |||
| epithelial cell of prostate | 1.47 | -1.47 | 1.00 | |||
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | -1.79 | 2.33 | 1.00 | |||
| TTC-1240 (Rhabdoid tumor of the kidney) | 2.06 | -2.03 | 1.00 |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis