rs13232310 chr7:142323834 C>T
- Sequence
ggaatgttggccacttgggggcgc[C/T]gtggccccactatgctgcagggaa
- ASB in cell types
- MCF7L-P(immortalized breast epithelial cell line) foreskin keratinocyte GM12878 (female B-cells lymphoblastoid cell line) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7L-P(immortalized breast epithelial cell line) | 1.73 | -3.88 | 2.00 | |||
| foreskin keratinocyte | 1.37 | -2.85 | 2.33 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.06 | 1.47 | 1.20 | |||
| K562 (myelogenous leukemia) | 0.56 | -0.11 | 1.46 | |||
| GM10847 (female B-cells Lymphoblastoid Cell Lines) | -0.27 | 1.89 | 1.00 |
Items per page:
1 – 5 of 12