rs13237261 chr7:152588656 C>T
- Sequence
atttattgtagatggcaaaaatga[C/T]gatatccagagaagagttatttta
- ASB for transcription factors
- GATA3_HUMAN RARA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA3_HUMAN | n/a | 2.60 | 2.00 | n/a | No Hit | |||
| RARA_HUMAN | 0.26 | 1.91 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, autism, autism with high iq, sporadic creutzfeldt-jakob disease, urinary albumin-to-creatinine ratio