rs13250 chr7:44986581 G>A
- Sequence
gcccaggatggcggtggatgacta[G/A]actgccgaagaccgcgccgctgcg
- ASB in cell types
- CD14+ monocytes neural cell breast tumor NGP (neuroblastoma)
- ASB for transcription factors
- MXI1_HUMAN STAT1_HUMAN MYCN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MXI1_HUMAN | -1.23 | 1.23 | 1.00 | n/a | No Hit | |||
| STAT1_HUMAN | 2.00 | 0.56 | 1.70 | n/a | No Hit | |||
| MYCN_HUMAN | 1.60 | -0.51 | 1.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Lung, Muscle_Skeletal, Nerve_Tibial, Spleen, Testis, Whole_Blood