rs13295574 chr9:136122960 G>A
- Sequence
gtcaccccagaaccaccgtgtgct[G/A]gggatttgtcacgggtttgtcctg
- ASB in cell types
- neural cell THP-1 (acute monocytic leukemia) neutrophils from periferal blood KMS-11 (Plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | 0.74 | -0.17 | 1.00 | |||
| THP-1 (acute monocytic leukemia) | -0.33 | 0.92 | 2.00 | |||
| neutrophils from periferal blood | 1.26 | 0.60 | 1.50 | |||
| KMS-11 (Plasma cell myeloma) | -0.25 | 1.22 | 1.50 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Heart_Left_Ventricle, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Testis