rs13303222 chr1:914618 A>G
- Sequence
ctgaggtgtgaggtgacagcaggt[A/G]aagagtgagccacaatcagcattt
- ASB in cell types
- TMD8 (diffuse large B-cell lymphoma) BEAS-2B (bronchial epithelium)
- ASB for transcription factors
- ITF2_HUMAN GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ITF2_HUMAN | -2.22 | 2.19 | 1.00 | n/a | No Hit | |||
| GCR_HUMAN | 2.21 | -1.89 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cortex, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood