rs13336428 chr16:1482462 G>A
- Sequence
gaagcacaactcggtgagtgactc[G/A]gggaaccgtcacgccggcatccgc
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ATF3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ATF3_HUMAN | n/a | 2.69 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, femoral neck areal bone mineral density (bmd), femoral neck bone mineral density (bmd), femoral neck bone mineral density (bmd) (females), femoral neck bone mineral density (bmd) (males), femoral neck bone mineral density (bmd) (postmenopausal females), femoral neck bone mineral density (bmd) (premenopausal), hypertension (early onset hypertension), lumbar spine areal bone mineral density (bmd), lumbar spine bone mineral density (bmd) (female), lumbar spine bone mineral density (bmd) (male), lumbar spine bone mineral density (bmd), lumbar spine bone mineral density (bmd) (postmenopausal females), spine bone mineral density (bmd), sporadic creutzfeldt-jakob disease, total hip bone mineral density (bmd) (postmenopausal females)