rs13339238 chr16:9258671 A>G
- Sequence
gtagtatcgcaacacctggcagga[A/G]ctgcaccccaggaccttgacaaag
- ASB in cell types
- T47D (invasive ductal carcinoma) GM19099 (female B-cells Lymphoblastoid Cell Lines) epithelial cell of proximal tubule erythroid progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 1.36 | -0.09 | 2.09 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | 0.94 | -0.76 | 1.00 | |||
| epithelial cell of proximal tubule | 2.74 | n/a | 1.00 | |||
| erythroid progenitors | 2.73 | n/a | 2.00 |
Items per page:
1 – 4 of 4