rs13383985 chr2:157599468 C>T
- Sequence
cggaacagggctgttgagctttcc[C/T]ggctcaacaagctcactctagata
- ASB in cell types
- VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | 0.51 | 2.29 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), comorbid depressive syndrome and alcohol dependence, cystatin c in serum, diastolic blood pressure (dbp), fasting insulin, hdl cholesterol, homa-ir, plasma aldosterone concentration, serum creatinine, spine bone mineral density (bmd), sporadic creutzfeldt-jakob disease, stabilized warfarin dose, tetrology of fallot, triglycerides, waist hip ratio