rs13408145 chr2:223815234 C>T
- Sequence
gaaaaatctttgagtactttttgg[C/T]atcaaaccaagaacacagtcatca
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells) BIN-67 (Ovarian small cell carcinoma, hypercalcemic type)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 1.81 | n/a | 4.00 | |||
| BIN-67 (Ovarian small cell carcinoma, hypercalcemic type) | 1.22 | -1.06 | 1.00 |
Items per page:
1 – 2 of 2