rs134222 chr22:35135764 G>C
- Sequence
agggtgagatgcaaacagggtcgg[G/C]aggccagtgagttgacagtttctc
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | 2.48 | -2.27 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.87 | 0.43 | 1.09 |
Items per page:
1 – 2 of 2