rs1345101 chr15:25793359 A>G
- Sequence
gagatgctgcagtgcctcatgcac[A/G]cttacaccctttaaaaagatatcg
- ASB in cell types
- MV-4-11 (Childhood acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MV-4-11 (Childhood acute monocytic leukemia) | 1.00 | 1.75 | 1.06 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, irritible bowel syndrome, microalbuminuria, nicotine initiation (smoking), parkinsons disease