rs134611 chr22:29080856 C>G
- Sequence
aacatcctagaatgcacaggagag[C/G]ccccacgccaaagagttatacagc
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- TEAD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TEAD4_HUMAN | -2.39 | 2.73 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Brain_Cerebellar_Hemisphere, Brain_Cortex, Breast_Mammary_Tissue, Heart_Left_Ventricle, Lung, Nerve_Tibial, Pancreas, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood