rs135109 chr22:35684459 T>C
- Sequence
cctgctctatagctcttggtggga[T/C]gtggcaatagcctctgactacaga
- ASB in cell types
- liver adrenal gland MOLM-13(acute monocytic leukemia(AML), Homo sapiens)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.15 | 0.45 | 1.54 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, arthritis including non-rheumatoid, cognitive response of healthy volunteers to topiramate treatment as measure by the color-word cognitive test, hdl cholesterol change with statins, ldl cholesterol, total cholesterol, triglycerides