rs135175 chr22:39216079 A>G
- Sequence
ggggcggccctgattgtttctacc[A/G]ctgctttgtcggctggcaggtgag
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines) GM12890 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.78 | 1.99 | 1.00 | n/a | n/a | |||
| CTCF_HUMAN | 0.36 | 0.80 | 1.24 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP general white matter integrity factor, height, hypertension (early onset hypertension), irritible bowel syndrome