rs135198 chr22:34105552 G>A
- Sequence
catacatccacattcaattagcaa[G/A]cagccctatgtctcaccttatcca
- ASB in cell types
- GM18526 (B – cells Lymphoblastoid Cell Lines) spleen
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18526 (B – cells Lymphoblastoid Cell Lines) | -2.13 | 2.50 | 1.00 | |||
| spleen | -2.02 | 2.46 | 1.00 |
Items per page:
1 – 2 of 2