rs13542 chr13:99986138 G>A
- Sequence
ggattgcgttcctccccgccttcc[G/A]ccccttcccttccctaaagtgatg
- ASB in cell types
- HEK293 (embryonic kidney) GM23248
- ASB for transcription factors
- EZH2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EZH2_HUMAN | -0.15 | 1.73 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, age at death with kuru exposure, birth weight, celiac disease, cleft lip, with or without cleft palate, hypertension (early onset hypertension), neuroblastoma (brain cancer), nonsyndromic cleft lip, prop taste detection threshold, rheumatoid arthritis, triglycerides