rs135449 chr22:47452380 G>C
- Sequence
tgagttttgtcttcctgtgaatgt[G/C]ttcaggtgcagaacacacaatgac
- ASB in cell types
- erythroid progenitors GM02255 (Lymphoblastoid Cell Lines) GM10847 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid progenitors | n/a | 3.44 | 3.00 | |||
| GM02255 (Lymphoblastoid Cell Lines) | 1.51 | -2.71 | 1.33 | |||
| GM10847 (female B-cells Lymphoblastoid Cell Lines) | -0.81 | 1.51 | 1.00 |
Items per page:
1 – 3 of 3