rs135710 chr22:38260679 A>G
- Sequence
agagggacggaataatgagtgaac[A/G]cagaaagcactgagaaggtctggc
- ASB in cell types
- monocytes from periferal blood MS-1 (Small cell lung carcinoma)
- ASB for transcription factors
- SRBP2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SRBP2_HUMAN | -1.08 | 2.04 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1