rs136329 chr22:30770036 G>A
- Sequence
ttataaaggggagttcccctgcac[G/A]tgctctcttgcctgctgccatgta
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- BHE40_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BHE40_HUMAN | 2.04 | -3.77 | 1.50 | -5.20 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood