rs136343 chr22:30755548 T>C
- Sequence
agcagcttccgaagtgtaggcctc[T/C]tttgacttcgggaagctttgtctt
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) PC9 (lung adenocarcinoma) GM18526 (B – cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN NR2C1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.48 | 0.06 | 1.00 | n/a | n/a | |||
| NR2C1_HUMAN | 2.27 | n/a | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2