rs1364063 chr16:69554669 T>C
- Sequence
agtctccctttcagatagtgacca[T/C]gtgacacagttctggccaatgaga
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) K562 (myelogenous leukemia)
- ASB for transcription factors
- MITF_HUMAN RAD51_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MITF_HUMAN | n/a | 3.96 | 2.00 | 1.60 | Weak Concordant | |||
| RAD51_HUMAN | -3.86 | 2.71 | 1.50 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration (geographic atrophy), age at menarche, body mass index (bmi), height, partial epilepsy, serum creatinine, triglycerides
PheWAS abnormal electrocardiogram, abnormal findings on examination of urine, abnormal findings on radiological breast exam, abnormal findings on radiological examination intrathoracic organs, abnormal glucose, abnormal involuntary movements, agorophobia, social phobia, and panic disorder, alcohol-related disorders, alcoholism, allergic reaction to food, aneurysm of other specified artery, angina pectoris, asthma with exacerbation, atherosclerosis of aorta, atrial fibrillation, atrial fibrillation & flutter, benign neoplasm of ovary, calculus of bile duct, cancer, suspected or other, cardiac arrest & ventricular fibrillation, cardiac conduction disorders, cellulitis and abscess of leg, chondrocalcinosis, conduct disorders, corneal degenerations, crystal arthropathies, dermatomycoses, dermatophytosis / dermatomycosis, diabetes mellitus, disorders of lipoid metabolism, disorders of muscle, ligament, and fascia, disorders of synovium, tendon, and bursa, enthesopathy, essential hypertension, fasciitis, fracture of clavicle or scapula, fracture of tibia and fibula, frequency of urination and polyuria, h. pylori, heart valve replaced, hepatic cancer, primary, hidradenitis, hypercholesterolemia, hyperglyceridemia, hyperlipidemia, hypertension, hypertensive heart and/or renal disease, hypocalcemia, idiopathic fibrosing alveolitis, intracranial hemorrhage, jaundice, liver replaced by transplant, lung disease due to external agents, melanoma, neoplasm of unspecified nature of digestive system, noninfectious gastroenteritis, open wound of nose and sinus, other abnormal blood chemistry, other abnormal glucose, other alveolar and parietoalveolar pneumonopathy, other dermatoses, other disorders of urethra and urinary tract, pallor and flushing, peripheral enthesopathies, photodermatitis & sunburn, pneumonitis due to inhalation of food or vomitus, precordial pain, retinal hemorrhage/ischemia, salicylates causing adverse effects in therapeutic use, skin neoplasm of uncertain behavior, sprains and strains, stiffness of joint, stricture of artery, superficial cellulitis and abscess, symptoms of the muscles, testicular dysfunction, testicular hypofunction, tinnitus, type 2 diabetes, type 2 diabetic ketoacidosis, type 2 diabetic nephropathy, type 2 diabetic neuropathy, vascular complications of surgery and medical procedures
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Brain_Substantia_nigra, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Uterus, Whole_Blood