rs137983 chr22:39932987 C>T
- Sequence
tgactccaaggctcatgtgcttgc[C/T]taccttacccagatggcggcagca
- ASB in cell types
- erythroid cells MS-1 (Small cell lung carcinoma) LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | 2.88 | -5.39 | 2.00 | |||
| MS-1 (Small cell lung carcinoma) | 0.51 | -0.14 | 1.00 | |||
| LNCaP (prostate carcinoma) | -0.86 | 1.37 | 1.00 |
Items per page:
1 – 3 of 3