rs138373 chr22:38398655 G>A
- Sequence
ccggccccccaaaagacacgggga[G/A]ccgcaagcgaggggtgcagccatc
- ASB in cell types
- HEK293 (embryonic kidney) GM02610 (Lymphoblastoid Cell Lines) SUM159PT (Triple negative breast cancer)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.20 | 0.87 | 1.95 | |||
| GM02610 (Lymphoblastoid Cell Lines) | 2.15 | -0.21 | 1.00 | |||
| SUM159PT (Triple negative breast cancer) | 1.48 | -0.95 | 1.00 |
Items per page:
1 – 3 of 3