rs138789 chr22:35334092 A>C
- Sequence
gcagaatcaatggatagcgttttg[A/C]ctgttctctaacgctcacagcagc
- ASB in cell types
- monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived dendritic cells | 2.23 | 0.07 | 1.62 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), fasting blood glucose, fasting insulin, hip bone mineral density (bmd), homa-ir, ldl cholesterol, spine bone mineral density (bmd), systolic blood pressure (sbp), total cholesterol, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Artery_Coronary, Artery_Tibial, Cells_Cultured_fibroblasts, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Spleen, Testis, Whole_Blood