rs139399638 chr5:317315 C>T
- Sequence
agcctgggccacgtgggggcagtg[C/T]ggctgcaccacggagctctcggga
- ASB in cell types
- transverse colon pancreas spleen
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| transverse colon | -0.66 | 2.46 | 1.00 | |||
| pancreas | -1.97 | 2.47 | 1.00 | |||
| spleen | -1.16 | 1.16 | 1.00 |
Items per page:
1 – 3 of 3