rs1394117 chr11:11075653 A>G
- Sequence
tgtgcctctgatggtggtgggatt[A/G]tgggagagggagggtgtgggtggt
- ASB in cell types
- bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| bipolar neuron | -1.56 | 2.12 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP fasting insulin, hdl cholesterol change with statins, homa-b, homa-ir, ldl cholesterol, total cholesterol