rs13959 chr9:72930966 G>A
- Sequence
ggaagcatccatagtacgccacgg[G/A]gatccaatctgaaaagcctgtctt
- ASB in cell types
- neural progenitors SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural progenitors | 2.28 | -1.76 | 1.00 | |||
| SK-N-SH (neuroblastoma) | 0.28 | 1.56 | 1.25 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Colon_Sigmoid, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Thyroid