rs1396237 chr14:77124527 T>A
- Sequence
gctggggaagagctcagaagccaa[T/A]gggatgtggatttcaatgtcttcc
- ASB in cell types
- primary B-CLL cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary B-CLL cells | 1.57 | n/a | 2.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Breast_Mammary_Tissue, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Spleen, Whole_Blood