rs139664063 chr21:46551810 G>A
- Sequence
cccggaggcgccagtgagcaagtc[G/A]ccctctcgtgcagttcctgttcct
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) GM02255 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | 1.50 | -0.98 | 1.00 | |||
| GM02255 (Lymphoblastoid Cell Lines) | -1.48 | 1.73 | 1.00 |
Items per page:
1 – 2 of 2