rs140423829 chr5:34445084 A>T
- Sequence
ttaggaacaggttgttcagtttcc[A/T]tgtagttgtgtggttttgactgag
- ASB in cell types
- LNCaP95
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP95 | 2.18 | -0.09 | 1.50 |
Items per page:
1 – 1 of 1