rs140679 chr15:27527530 C>T
- Sequence
gaccgccatggacctttttgtgac[C/T]gtgtgcttcctgtttgtcttcgcc
- ASB in cell types
- RWPE2 LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| RWPE2 | -2.69 | 2.77 | 1.00 | |||
| LNCaP (prostate carcinoma) | 1.27 | -0.76 | 1.00 |
Items per page:
1 – 2 of 2