rs1408953 chr1:17552124 T>C
- Sequence
actccatggggctggtgcaggatt[T/C]gattaacaggtcacatgaggccag
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells) monocyte-derived macrophages from peripheral blood
- ASB for transcription factors
- TF65_HUMAN STAT3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 2.03 | -0.63 | 1.88 | n/a | No Hit | |||
| STAT3_HUMAN | 2.48 | n/a | 2.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP maternal transmission distortion, partial epilepsy, spine bone mineral density (bmd), total cholesterol, transmission distortion