rs140995238 chr3:122384294 C>T
- Sequence
ggagcctcagcggtctgcgcctgg[C/T]agcaggtgagacgccggtcgggat
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) erythroid cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.78 | 0.46 | 1.24 | |||
| erythroid cells | 2.19 | n/a | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid