rs141449831 chr5:134411663 C>G
- Sequence
ggcccagaccatggagagggagag[C/G]agctggtccaggcggccactgccg
- ASB in cell types
- pancreas
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| pancreas | 2.05 | -1.70 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Heart_Atrial_Appendage, Nerve_Tibial, Pancreas, Pituitary