rs1417209 chr10:71379028 C>T
- Sequence
ttcagggaggaccaaatgctctgc[C/T]aaatgctttgctctcattgtctgc
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) GM12878 (female B-cells lymphoblastoid cell line) MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | 3.01 | -3.10 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | -0.10 | 1.07 | 1.06 | |||
| MS-1 (Small cell lung carcinoma) | -2.24 | 2.60 | 1.00 |
Items per page:
1 – 3 of 3