rs141971736 chr3:50503592 C>T
- Sequence
cacgggccgcagcgcctctgcggg[C/T]tgcgcgctgctatctccctgcagc
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | 1.94 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1