rs142143494 chr15:28739160 T>A
- Sequence
cagtcagcttttcatcttcaactt[T/A]ataactttcacctgaggatatgag
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- MEF2B_HUMAN RELB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MEF2B_HUMAN | 2.53 | -2.23 | 1.00 | n/a | No Hit | |||
| RELB_HUMAN | 2.31 | -0.82 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Cells_Cultured_fibroblasts, Lung, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Spleen