rs142419228 chr2:189674447 T>A
- Sequence
ttgggatgatgcgcacgcgggggg[T/A]ctgagccagccaaggggccgggcg
- ASB in cell types
- GM18951 (B-cells Lymphoblastoid Cell Lines) breast tumor HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18951 (B-cells Lymphoblastoid Cell Lines) | -1.00 | 1.13 | 1.00 | |||
| breast tumor | 2.84 | n/a | 2.00 | |||
| HepG2 (hepatoblastoma) | 0.78 | 0.20 | 1.99 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood